Muscle Resting and TGF-β Inhibitor Treatment Prevent Fatty Infiltration Following Skeletal Muscle Injury
Allan F. Paganoa,b Coralie Arc-Chagnauda,c Thomas Briochea Angèle Choparda
Guillaume Pya
aUniversité de Montpellier, INRA, UMR866 Dynamique Musculaire et Métabolisme, Montpellier, France, bUniversité de Strasbourg, Faculté des Sciences du Sport, Mitochondries, Stress Oxydant et Protection Musculaire, Strasbourg, France, cFreshage Research Group, Department of Physiology, University of Valencia, CIBERFES, INCLIVA, Valencia, Spain
Key Words
Muscle regeneration • Intermuscular adipose tissue (IMAT) • Fibro-adipogenic progenitors (FAPs) • Hindlimb unloading • Exercise
Abstract
Background/Aims: Skeletal muscle injuries are the most common type of injury occurring in sports, and investigating skeletal muscle regeneration as well as understanding the related processes is an important aspect of the sports medicine field. The process of regeneration appears to be complex and precisely orchestrated, involving fibro-adipogenic progenitors (FAPs) which are a muscle-resident stem cell population that appears to play a major role in abnormal development of fibrotic tissue or intermuscular adipose tissue (IMAT). Our present study aims to investigate whether muscle resting or endurance exercise following muscle injury may change the behavior of FAPs and subsequently impact the development of fatty infiltrations and fibrosis, two hallmarks of regeneration failure. Methods: We used the validated glycerol muscle injury model to mimic abnormal muscle regenerative conditions in mice. We challenged this specific regeneration model with hindlimb unloading or endurance exercise and, in a second set of experiments, we treated mice with decorin, a TGF-β inhibitor. Results: In this study, we demonstrated that: i) muscle resting just after injury leads to inhibition of IMAT development, ii) TNF-α mediated FAP apoptosis might be perturbed in this specific glycerol model of muscle injury, leading to IMAT development, and iii) treatment with the TGF-β inhibitor decorin decreases IMAT development and might restores FAP apoptosis. Conclusion: In addition to the potential clinical relevance of decorin treatment in situations involving muscle plasticity and regeneration, this study also demonstrates that a period of muscle resting is necessary following muscle injury to achieve efficient muscle regeneration which is associated with a reduction in fatty infiltration. Unreasonably early resumption of exercise brings no gain to regeneration, further highlighting that this resting period is necessary.
Introduction
Skeletal muscle injuries are the most common type of injury occurring in sport practice and studies investigating skeletal muscle regeneration and the processes related to it are not fully understood. In a healthy but injured muscle, a regeneration process leads to the establishment of new myofibers and to efficient repair of damaged tissue, thus restoring the original muscle integrity [1]. Successful skeletal muscle regeneration appears to be a complex and precisely orchestrated process involving multiple cell types. Of these cell types, satellite cells, localized between the sarcolemma and the basal lamina of myofibers [2], are the most commonly studied and are known to support the regeneration processes after injury. Nevertheless, a growing number of studies describing the crucial role of the interaction between the inflammatory/immune systems and muscle-resident stem cells are gradually highlighting the complexity of muscle regeneration [3-5].
The abnormal development of fibrotic and/or intermuscular adipose tissue (IMAT) deposits within skeletal muscle is a strong marker of regenerative failure. Studies have shown that increased IMAT deposition in skeletal muscle is strongly associated with decreased force production and overall muscle function [6, 7] as well as decreased mobility in older adults [8-10]. The level of IMAT deposition has also been correlated to the severity of Duchenne muscular dystrophy [11, 12]. Moreover, sizeable fatty infiltration occurs after rotator cuff injuries [13, 14] and a study by Goutallier, et al. [15] previously showed that the amount of IMAT infiltration was directly linked to decreased muscle function and to the severity of the injury. In line with these studies, Rahemi, et al. [16] generated a mathematical model arguing that IMAT inclusion was directly linked, through modifying pennation angle of fibers, to a decrease in muscle force and quality. Importantly, skeletal muscle fatty degeneration appears to be irreversible following rotator cuff tears, highlighting the importance of preventing their development.
Among the existing muscle-resident stem cells, numerous studies have highlighted the importance of fibro/adipogenic progenitors (FAPs), expressing the cell surface marker platelet-derived growth factor receptor alpha (PDGFRα or CD140a), in achieving efficient skeletal muscle regeneration. FAPs are able to rapidly proliferate following injury, participate in the phagocytosis of necrotic muscle fibers, and support satellite cell-mediated muscle regeneration [17-19]. In contrast, under pathological conditions, muscle disuse, or even in glycerol-induced muscle degeneration, FAPs have been shown to contribute to IMAT and fibrosis development [20-22]. Moreover, Uezumi, et al. [20] have demonstrated that only PDGFRα-positive cells can differentiate into adipocytes in glycerol-injected regenerating muscles thereby demonstrating the major implication of FAPs, which represent 98% of PDGFRα-positive cells in a regenerating muscle, in IMAT development.
The glycerol model of muscle injury, originally developed in rabbits [23], is now regularly used to investigate IMAT development and the related adipogenic process [18, 20, 22, 24, 25]. A study by Lukjanenko, et al. [22] showed an increase in the adipogenic response amplitude in glycerol-injected muscle compared to the classic cardiotoxin injury model, leading the glycerol model to be associated with IMAT development and accumulation. This study also highlighted that the glycerol-injected regenerating muscles showed a greater induction of anti-inflammatory cytokine mRNAs, as demonstrated by an approximately 2-fold higher expression of TGF-β1 and IL-10. The authors concluded that glycerol-injected muscles were characterized by a stronger anti-inflammatory response, suggesting an earlier M1 to M2 macrophage phenotype transition in comparison with cardiotoxin-induced muscle regeneration, thus affecting IMAT development. In light of a recent study demonstrating that TNFα released by M1 macrophages induces FAP apoptosis while TGF-β1 released by M2 macrophages promotes FAP survival [19], it is likely that pro-inflammatory processes may be dysregulated in the glycerol model. Clearly, studies are still necessary to clarify the impact of macrophages phenotype and more importantly macrophages phenotype transition during glycerol model of muscle regeneration on the IMAT development.
In a previous study, we demonstrated for the first time an almost complete inhibition of IMAT development in glycerol-injected regenerating muscles following hindlimb unloading [25]. Numerous studies have reported that hindlimb unloading leads to a pro-inflammatory environment within the muscle, with substantial macrophage infiltration [26-28], leading us to investigate the role of inflammatory processes on the inhibition of IMAT development observed in this situation. Aside unloading, it is well accepted that regular exercise has anti-inflammatory effects on skeletal muscle, suggesting that physical activity per se may suppress systemic low-grade inflammation that is often a hallmark of chronic diseases [29]. Moreover the levels of numerous circulating cytokines implicated in both inflammatory and anti-inflammatory pathways also fluctuate following exercise [30, 31]. However, the question of whether an early increase of muscle activity following injury, in the form of endurance exercise, could limit or exacerbate IMAT development in regenerating glycerol-injected muscle has not yet been addressed.
Consequently, this study was first designed to test the effect of early and regular endurance exercise on IMAT development in the glycerol-injected regenerating muscle. Secondly, we investigated the underlying mechanisms involved in the IMAT inhibition previously observed with hindlimb unloading, treating glycerol-injected muscle with decorin, a myokine known to interact with Transforming Growth Factor (TGF-β) family members. As highlighted above, the macrophages phenotype transition is a crucial stage during muscle regeneration, and can be characterized by their capacity to produce specific cytokines, like TNFα and TGF-β. In our study, decorin treatment, a natural antagonist of TGF-β, has been performed in order to better characterize the role of the TNFα/TGF-β axis during glycerol-induced muscle regeneration.
Materials and Methods
Ethics statement
This study was approved by the Committee on the Ethics of Animal Experiments of Languedoc Roussillon in accordance with the guidelines from the French National Research Council for the Care and Use of Laboratory Animals (CEEA-LR-14002). This study is in adherence to the Directive 210/63/EU for animal care standards. All efforts were made to minimize animal suffering.
Animals
Experiments were carried out on at least 6-month-old C57BL6J female mice from our own colony. Animals were maintained on a 12h/12h light–dark cycle and provided with food and water ad libitum. Experiments were performed at 22°C.
Experimental groups and muscle sampling
Experimental procedures were performed under anesthesia using isoflurane inhalation.
In a first set of experiments, mice were injected with 25μl of 50% v/v glycerol in the right tibialis anterior (TAg), and with 25 μL of saline solution in the contralateral tibialis anterior (TA) and then subjected to exercise training (EX group, training sessions detailed hereafter).
In a second set of experiments, mice were injected with 25μl of 50% v/v glycerol in the right tibialis anterior (TAg), and with saline solution in the contralateral tibialis anterior (TA) and then multiple experimental groups were formed: hindlimb-unloaded (HU), trained (EX) and control (CTL) groups for three different time points (2, 3 and 21 days). TA-CTL muscles have been used, when permitted, as reference control in our subsequent analyses.
In a third set of experiments, mice were injected with 25μl of 50% v/v glycerol in both tibialis anterior (TAg) muscles, and two experimental groups were formed: a decorin-treated group (DECO) and a control PBS-treated group (PBS) for each of three different time points (5, 9 and 21 days). Decorin (D8428-.5MG, Sigma-Aldrich) treatments were administered 3 and 6 days after injury with intra-muscular injections in the right TAg (50μg of decorin diluted in 25μl of PBS), while the left TAg was injected with 25μl of PBS. At the end of the protocol, for each mouse one TAg was rapidly dissected out and immediately fixed overnight in a 4% paraformaldehyde solution at room temperature, after which it was paraffin-embedded. The second TAg was dissected out and rapidly frozen in liquid nitrogen.
Training sessions
Training sessions were conducted on a motor-driven treadmill (Exer-6M Treadmill; Columbus Instruments). The training protocol started 2 days after glycerol injection. Mice rigorously performed the same training program consisting of 8 exercise sessions distributed among the remaining 19 days of the protocol. In each exercise session, mice ran at 10m/min for 10min, following by a running speed increase of 1m/min every 2min for an additional 16min (thus until 18m/min speed). The speed was then maintained at 18m/min until 45 minutes of exercise had been performed. In order to get rid of the acute exercise effects, for the early time points of our study (at 2 and 3 days post-glycerol injection), mice of the EX groups either performed an exercise session 1 day after the glycerol injection and were euthanized 1 day later (TAg-EX 2 days), or performed two sessions, 1 and 2 days after glycerol injection, and were euthanized 1 day after the final session (TAg-EX 3 days).
Paraffin-embedded histological and immunohistochemical analyses
The paraffin-embedded histological and immunohistochemical analyses were performed exactly as previously described [32].
mRNA extraction and real-time polymerase chain reaction (qPCR)
Total RNA was isolated from muscle homogenates using the RNeasy Fibrous Tissue Mini Kit following the manufacturer’s instructions (Qiagen). RNA concentration was determined by spectrophotometric analysis (Eppendorf AG, Hamburg, Germany), and integrity was checked by the OD260nm/OD280nm absorption ratio (>1.7). Reverse transcription reaction was performed with 2μg of total RNA using the RevertAid First Strand cDNA Synthesis kit (Thermo Scientific) according to the manufacturer’s instructions. qPCR analysis was performed in a MiniOpticon detection system (Bio-Rad, Hercules, CA) with 10μL of KAPA SYBR Fast Universal Readymix (CliniSciences), 300nM of both forward and reverse primers, 2μL of diluted cDNA template and water to a final volume of 20μL. PCRs were performed in duplicate using the following cycle parameters: 30s at 98°C, 40 cycles of 1s at 95°C and 15s at 60°C. Relative mRNA levels were normalized to rp-S9 and tubulin housekeeping gene levels, which were unaffected by the experiment. Results are expressed using the comparative cycle threshold (CT). The relative changes in the level of a specific gene were calculated with the ΔΔCT formula. Tgfb1 (NM_011577.1) primer sequences were GCAACATGTGGAACTCTACCAG for the forward primer and CAGCCACTCAGGCGTATCA for the reverse primer.
Protein isolation and Western Blotting
The Western Blot protocol was performed as previously described [32]. β-actin was used as a loading control for homemade gels whereas Stain Free technology was used with Bio-Rad precast gels [33].
Antibodies
Anti-PDGFRα (#3174), anti-perilipin (#9349), anti-FABP4 (#3544) and anti-C/EBPα (#8178) primary antibodies were purchased from Cell Signaling and used at 1:500. Anti-PPARγ (sc-7273; 1:200), anti-C/EBPβ (sc-150; 1:200) anti-TNFα (sc-52746; 1:200), and anti-β-actin (sc-81178; 1:4000) primary antibodies were purchased from Santa Cruz. Anti-mouse (sc-2005) and anti-rabbit (sc-2004) HRP-conjugated secondary antibodies were purchased from Santa Cruz and used at 1:4000.
Statistics
All values are expressed as mean ± SEM and the significance level was set as p<0.05. Differences between the two groups were evaluated for significance using the unpaired Student t-test or the Mann-Whitney test when data deviated from a normal distribution (Shapiro-Wilk normality test). When more than two simultaneous comparisons were made, one-way or two-way ANOVA was employed to compare data (level of mechanical constraints or treatment and time factors). When a significant effect was indicated, a Fisher significant difference post-hoc test was performed. All statistics and graphs were made with GraphPad Prism 6 Software.
Results
Reduced muscle activity, but not endurance exercise, decreases IMAT development after injury
In our previous study [25], we demonstrated that the area occupied by IMAT 21 days after mouse tibialis anterior glycerol injection (TAg) reached 2.83% of the total muscle CSA in the CTL group, whereas hindlimb unloading (HU) almost completely inhibited IMAT development, significantly decreasing the area occupied by IMAT (0.08%, Fig. 1). In the present study we further measured IMAT deposition in an exercise-trained group (EX) and observed no differences between the TAg-EX and the previously reported TAg-CTL group (2.24% of the total muscle CSA in the EX group and 2.83% in the CTL group, Fig. 1). In regards to the results obtained from this EX group, we further performed new experiments including the three groups (CTL, EX and HU) and measured mature adipocyte markers within total muscle lysates by Western blot to confirm and support the presence or absence of IMAT. As expected, we observed no differences in the adipocyte markers perilipin and FABP4 in the TAg-EX group compared to the TAg-CTL group, but a clear decrease of these markers in the TAg-HU condition, with -84% for perilipin and -61% for FABP4 when compared to TAg-CTL (p=0.03 and p=0.038 respectively, Fig. 2A). We next investigated levels of PPARγ and C/EBPα, two important transcription factors implicated in adipogenesis, and found a similar decrease in their protein expression in only the TAg-HU condition (-58% for PPARγ, p=0.038, and -89% for C/EBPα compared to TAg-CTL, p=0.0011, Fig. 2B). Altogether, these results suggest an important role of reduced muscle activity immediately following injury in the inhibition of IMAT development and accumulation in glycerol-induced skeletal muscle injury. In contrast, performing endurance exercise as soon as 48h post-injury did not inhibit adipogenesis compared to control conditions.
Glycerol-induced muscle injury likely disturbs FAP apoptosis, which may be restored by HU
FAPs are known to rapidly proliferate following injury, and reach peak expression around 3 days post-injury [18, 19]. After peak expression, FAPs enter an apoptotic phase, and return to basal levels observed in an uninjured muscle within 9 days post-injury. In our experiments we observed a clear decrease in FAP levels, represented by expression of their specific cell surface marker PDGFRα, in HU group compared to the CTL and EX groups 21 days after glycerol injection (-54%, and -57%, p=0.0154 and p=0.0184 respectively, Fig. 3A). This result was confirmed by immunohistochemical PDGFRα staining of muscle cross-sections (-74% compared to the TAg-CTL group, p=0.05 Fig. 3B). We thus show that, unlike in the HU group, FAP expression did not return to basal values in the CTL and EX groups, and these results all coincide with the degree of IMAT infiltration observed in each group. We next wanted to evaluate if this increase in FAP levels was due to an increase in FAP proliferation during the early stages of the regeneration process. For that purpose, we collected samples at 2 and 3 days post-glycerol injection, and found a massive and expected increase in PDGFRα signal in all groups between day 2 and 3. However, there were no differences between groups at either day 2 or 3, meaning that FAP proliferation was not affected by activity levels (Fig. 4A). Knowing that 98% of PDGFRα-positive cells represent FAPs in that specific glycerol model of regeneration [18], we therefore assumed that PDGFRα protein expression correlates with FAP levels. A result confirmed in our subsequent immunohistochemical PDGFRα staining (Fig. 4B). These results might indicate a defective transition in FAPs from proliferation to apoptosis in our CTL and EX groups, which is restored by the HU condition. We next looked at levels of TNFα, a key cytokine secreted by M1 pro-inflammatory macrophages and implicated in the promotion of FAP apoptosis, and TGF-β1, released by M2 macrophages and implicated in FAP survival [19]. We found a considerable increase in the expression of TNFα within the TAg muscle of our HU group 3 days post-injury (+405% compared to the TAg-CTL and +443% compared to the TAg-EX, p=0.003, Fig. 4C). This result coincided with decreased induction of TGF-β1 mRNA in the TAg-HU group (-49% compared to the TAg-CTL, p=0.025 and -24% compared to the TAg-EX, p=0.064, Fig. 4C). These results again strongly suggest that FAP apoptosis is inhibited in our CTL and EX groups, which may directly stimulate IMAT development. To compliment the results obtained regarding IMAT development, we also quantified C/EBPβ protein expression in the early time points. Expression of this key early marker of adipogenesis did not increase in the HU group, while in the CTL and EX groups a large increase was observed on day 3 (approximately a 3-fold increase compared to TA-CTL, p<0.001, Fig. 4D). This result highlights once again the important role of reducing muscle activity in the inhibition of adipogenesis following glycerol injury.
Decorin treatment inhibits IMAT development in the glycerol model of muscle injury
In order to confirm that IMAT development in the glycerol model of muscle injury is due to a perturbed macrophage phenotype shift, and thus to an unbalanced cytokine response, we further treated injured animals with decorin, a small leucine-rich proteoglycan. Decorin is an extracellular matrix protein within all collagen-containing tissues and is known to strongly inhibit activities of the TGF-β superfamily. We chose to inject decorin at 3 and 6 days after glycerol injury based on FAP proliferation/apoptosis time course during muscle regeneration. FAP expression reaches a peak at 3 days after injury and returns to basal values within 9 days following apoptosis [18, 19]. According to our results, we suggest that FAP apoptosis may be deregulated in this glycerol model of injury leading to an increased FAP expression and the development of IMAT. Therefore, we chose to inject decorin first at day 3, exactly at the time when FAPs are supposed to enter into their apoptotic stage, and then again at day 6 with the hypothesis that decorin could restore TNFα-mediated FAP apoptosis through TGF-β1 inhibition.
In our experiments, intramuscular administration of decorin at 3 and 6 days after glycerol injury strongly inhibited IMAT deposition 21 days post-glycerol injection. More precisely, IMAT deposits reached around 6% of total muscle area in the PBS-treated group, while IMAT infiltration was largely inhibited with decorin treatment, with deposits totaling about 1% of muscle area (Fig. 5A). Interestingly, we believe that the path of the needle and the PBS injection could have worsened the glycerol injury, and be the reason why IMAT deposits reached levels as high as 6% in this specific experiment. Along with the decrease observed in IMAT accumulation, quantification of perilipin (-71%), C/EBPα (-49%) and, to a lesser extent, FABP4 (-25%) protein levels in glycerol-injured muscle treated with decorin also confirmed a reduction of adipocyte differentiation (p=0.012, p=0.004 and p=0.06 respectively, Fig. 5B). Finally, when looking at the decorin-treated and control muscles at 5 and 9 days post-glycerol injection, we observed a decrease at day 5 in the expression of the major early adipogenic factor C/EBPβ (-32%, p=0.012, Fig. 6A).
Our first experiments suggested defective FAP apoptosis in the glycerol-injected model of muscle regeneration, resulting in a higher expression of PDGFRα 21 days following injury. Subsequently, our results, with respect to PDGFRα protein expression at 5 and 9 days after glycerol injury (thus during the theoretical FAP apoptosis stage) confirm that decorin treatment is able to strongly reduce PDGFRα protein expression, a result suggesting an increase in FAP apoptosis processes. Indeed, PDGFRα expression strongly decreased, at day 5 and 9, in our decorin-treated injured muscles compared to PBS-treated muscles (-44% and -55%, p=0.038 and p=0.04 respectively Fig. 6B).
Discussion
Using the glycerol model of muscle regeneration, we have highlighted the important benefit of immediate muscle resting following injury and emphasized the role of FAP apoptosis on IMAT development in muscle. We have also highlighted that maintaining natural inflammatory processes after muscle injury decreases IMAT development. Our previous study demonstrated inhibition of IMAT development in the HU condition 21 days following glycerol injury [25]. In the present work, we therefore studied a contrasting third group of mice who were subjected to exercise training in order to increase activity of the regenerating muscle. The percentage of IMAT deposition measured in this group 21 days after injury was almost the same that of the CTL group, and protein quantification of several key markers of adipogenesis and mature adipocytes further confirmed this result. These findings reflect once again the importance of removing or at least reducing muscle activity after injury to achieve efficient muscle regeneration. However, our lab and others have also shown perturbed muscle regrowth after regeneration processes in HU conditions [25, 34], which highlights the importance of increasing muscle activity levels as soon as possible after the necessary rest period for full recovery of muscle fiber size. Indeed, further studies are still needed to determine the ideal timeframe for transitioning between muscle resting and muscle activity after injury.
While many stem cells in the muscle environment can adopt the capacity to differentiate into adipocytes [4, 35], FAPs are currently accepted to represent the major population that appears to play a role in IMAT development. A study by Uezumi, et al. [20] clearly showed that only progenitors expressing the cell surface receptor PDGFRα were able to differentiate into adipocytes in the glycerol model of muscle injury. Importantly, the study by Heredia, et al. [17] subsequently confirmed that PDGFRα was exclusively expressed by FAPs after muscle injury. Monitoring FAP fate is therefore a major objective in promoting optimal muscle regeneration and preventing IMAT development. In healthy muscle FAPs are known to rapidly proliferate, reach peak expression around 3 days after muscle injury [18, 19], and aid regeneration by both improving muscle satellite cell activation and via their important phagocytic activity [17, 18]. After these key events, FAPs enter a period of apoptosis and their levels return to the basal values observed in uninjured muscle, a required process for efficient regeneration without abnormal fibrosis development [19]. In this study, we showed an approximately 2-fold increase of PDGFRα protein expression 21 days post-injury in the CTL and EX groups compared to the HU group. This can be interpreted either as an increase in FAP proliferation or as a deficiency in their apoptotic process, ultimately leading to IMAT development. Interestingly, our study revealed no differences in FAP proliferation at days 2 and 3 post-glycerol injury between all experimental groups, suggesting a disturbed FAP apoptosis in these groups. In accordance with the fact that TNFα, released by M1 macrophages, provokes FAP apoptosis [19], we also detected a strong increase in TNFα protein expression 3 days after injury in the HU group, but not in CTL and EX groups. These results strongly suggest that altered FAP apoptosis is a critical factor explaining, at least in part, IMAT development in the glycerol model of muscle regeneration. Interestingly, the study of Lukjanenko, et al. [22] already showed an unusual early anti-inflammatory response in the glycerol model compared to the cardiotoxin model of muscle injury. These authors revealed elevated levels of TGF-β1 three days after glycerol injury and, in line with the study conducted by Lemos, et al. [19], this strong TGF-β1 response promotes FAP survival through inhibition of TNFα-mediated FAP apoptosis. Interestingly, we also reported a reduction in mRNA levels of TGF-β1 3 days after injury in our HU group compared to the CTL and EX groups. Thus, immediately decreasing muscle activity after glycerol injury may participate in the recovery of FAP apoptosis through increased expression of TNFα.
In order to confirm involvement of the TNFα/TGF-β1 axis in the IMAT development observed in the abnormal muscle regeneration, we treated injured muscle with decorin, a small leucine-rich proteoglycan localized in the extracellular matrix of all collagen-containing tissues. This myokine [36] is a major inhibitor of the TGF-β superfamily, including TGF-β1 and myostatin, and its overexpression leads to major positive effects on muscle regeneration and limits the occurrence of abnormal fibrosis during the regeneration process [37-39]. Interestingly, decorin treatment has also been found to improve macrophage activity [40]. We therefore hypothesized that decorin treatment could inhibit IMAT development in the glycerol model of muscle regeneration. We also hypothesized that decorin could restore TNFα-mediated FAP apoptosis through TGF-β1 inhibition. Indeed, we observed inhibition of IMAT development in the decorin-treated muscles compared to PBS-treated and injured muscles, and confirmed this result by demonstrating decreased expression of key markers of mature adipocytes and adipogenesis. Analysis of the marker PDGFRα at day 5 and 9 post-injury, the critical time in which FAPs are in an apoptotic period, revealed a decreased expression with decorin treatment, possibly indicating a decreased FAP presence with decorin treatment. These results strongly suggest a restoration of the FAP apoptosis process leading to IMAT inhibition and other studies with specific proliferation and/or apoptosis measurements are needed to confirm and validate our hypothesis.
Conclusion
To conclude, this study raised three major points: i) muscle resting immediately after injury leads to prevention of IMAT development in the glycerol model of skeletal muscle injury, whereas early endurance exercise has no beneficial effect, ii) TNF-α mediated FAP apoptosis might be perturbed in abnormal muscle regeneration, leading to increased IMAT development, and iii) treatment with decorin, a TGF-β1 inhibitor decreases IMAT development in this specific model of muscle injury, certainly through an increase in FAP apoptosis. In addition to the potential clinical relevance of decorin treatment in situations involving muscle plasticity and regeneration, this study also raises questions about the appropriate timing for reestablishing muscle activity after sports injuries. From our point of view, ideal timing could be at the resolution of pro-inflammatory mechanisms, when the M1 to M2 macrophage phenotype shift occurs and the FAPs enter apoptosis, leading to a muscle environment primed to accomplish pro-regenerative and fibers regrowth functions.
Acknowledgements
Our studies are supported by the Centre National d’Etudes Spatiales (CNES). We especially thank Laurence Vico for providing the materials used in the tail-suspension experiments. The authors greatly acknowledge the “Réseau d’Histologie Expérimentale de Montpellier” (RHEM) platform for their assistance with histology core facilities and for paraffin processing of the tibialis anterior muscles, and especially Nelly Pirot, Florence Bernex, Charlène Berthet, Yohan Noël and Laura De Oliveira. We also thank the animal staff from our METAMUS platform facility, which belongs to the “Montpellier animal facilities network” (RAM), as well as the “Montpellier RIO Imaging” (MRI) platform for the use of the Nanozoomer. Finally, we also want to greatly thank Nadine Adam for her very helpful support with English revisions. All the authors of this study fulfill the 4 criteria of the ICMJE authorship recommendations.
Disclosure Statement
The authors have no conflicts of interest to declare.
References
|
1 Charge SB,
Rudnicki MA: Cellular and molecular regulation of muscle regeneration.
Physiol Rev 2004;84:209-238. |
|
|
|
|
|
2 Mauro A: Satellite
cell of skeletal muscle fibers. J Biophys Biochem Cytol 1961;9:493-495. |
|
|
|
|
|
3 Aurora AB, Olson
EN: Immune modulation of stem cells and regeneration. Cell Stem Cell
2014;15:14-25. |
|
|
|
|
|
4 Sciorati C,
Clementi E, Manfredi AA, Rovere-Querini P: Fat deposition and accumulation in
the damaged and inflamed skeletal muscle: cellular and molecular players.
Cell Mol Life Sci 2015;72:2135-2156. |
|
|
|
|
|
5 Brioche T, Pagano
AF, Py G, Chopard A: Muscle wasting and aging: Experimental models, fatty
infiltrations, and prevention. Mol Aspects Med 2016;50:56-87. |
|
|
|
|
|
6 Goodpaster BH,
Carlson CL, Visser M, Kelley DE, Scherzinger A, Harris TB, Stamm E, Newman
AB: Attenuation of skeletal muscle and strength in the elderly: The Health
ABC Study. J Appl Physiol (1985) 2001;90:2157-2165. |
|
|
|
|
|
7 Delmonico MJ,
Harris TB, Visser M, Park SW, Conroy MB, Velasquez-Mieyer P, Boudreau R,
Manini TM, Nevitt M, Newman AB, Goodpaster BH, Health, Aging and Body:
Longitudinal study of muscle strength, quality, and adipose tissue
infiltration. Am J Clin Nutr 2009;90:1579-1585. |
|
|
|
|
|
8 Marcus RL, Addison
O, Dibble LE, Foreman KB, Morrell G, Lastayo P: Intramuscular adipose tissue,
sarcopenia, and mobility function in older individuals. J Aging Res
2012;2012:629637. |
|
|
|
|
|
9 Tuttle LJ,
Sinacore DR, Mueller MJ: Intermuscular adipose tissue is muscle specific and
associated with poor functional performance. J Aging Res 2012;2012:172957. |
|
|
|
|
|
10 Beavers KM,
Beavers DP, Houston DK, Harris TB, Hue TF, Koster A, Newman AB, Simonsick EM,
Studenski SA, Nicklas BJ, Kritchevsky SB: Associations between body
composition and gait-speed decline: results from the Health, Aging, and Body
Composition study. Am J Clin Nutr 2013;97:552-560. |
|
|
|
|
|
11 Wren TA, Bluml S,
Tseng-Ong L, Gilsanz V: Three-point technique of fat quantification of muscle
tissue as a marker of disease progression in Duchenne muscular dystrophy:
preliminary study. AJR Am J Roentgenol 2008;190:W8-12. |
|
|
|
|
|
12 Gaeta M, Messina
S, Mileto A, Vita GL, Ascenti G, Vinci S, Bottari A, Vita G, Settineri N,
Bruschetta D, Racchiusa S, Minutoli F: Muscle fat-fraction and mapping in
Duchenne muscular dystrophy: evaluation of disease distribution and
correlation with clinical assessments. Preliminary experience. Skeletal
Radiol 2012;41:955-961. |
|
|
|
|
|
13 Laron D, Samagh
SP, Liu X, Kim HT, Feeley BT: Muscle degeneration in rotator cuff tears. J
Shoulder Elbow Surg 2012;21:164-174. |
|
|
|
|
|
14 Kuzel BR, Grindel
S, Papandrea R, Ziegler D: Fatty infiltration and rotator cuff atrophy. J Am
Acad Orthop Surg 2013;21:613-623. |
|
|
|
|
|
15 Goutallier D,
Postel JM, Bernageau J, Lavau L, Voisin MC: Fatty muscle degeneration in cuff
ruptures. Pre- and postoperative evaluation by CT scan. Clin Orthop Relat Res
1994:78-83. |
|
|
|
|
|
16 Rahemi H, Nigam
N, Wakeling JM: The effect of intramuscular fat on skeletal muscle mechanics:
implications for the elderly and obese. J R Soc Interface 2015;12:20150365. |
|
|
|
|
|
17 Heredia JE,
Mukundan L, Chen FM, Mueller AA, Deo RC, Locksley RM, Rando TA, Chawla A:
Type 2 innate signals stimulate fibro/adipogenic progenitors to facilitate
muscle regeneration. Cell 2013;153:376-388. |
|
|
|
|
|
18 Joe AW, Yi L,
Natarajan A, Le Grand F, So L, Wang J, Rudnicki MA, Rossi FM: Muscle injury
activates resident fibro/adipogenic progenitors that facilitate myogenesis.
Nat Cell Biol 2010;12:153-163. |
|
|
|
|
|
19 Lemos DR,
Babaeijandaghi F, Low M, Chang CK, Lee ST, Fiore D, Zhang RH, Natarajan A,
Nedospasov SA, Rossi FM: Nilotinib reduces muscle fibrosis in chronic muscle
injury by promoting TNF-mediated apoptosis of fibro/adipogenic progenitors.
Nat Med 2015;21:786-794. |
|
|
|
|
|
20 Uezumi A, Fukada
S, Yamamoto N, Takeda S, Tsuchida K: Mesenchymal progenitors distinct from
satellite cells contribute to ectopic fat cell formation in skeletal muscle.
Nat Cell Biol 2010;12:143-152. |
|
|
|
|
|
21 Uezumi A, Ito T,
Morikawa D, Shimizu N, Yoneda T, Segawa M, Yamaguchi M, Ogawa R, Matev MM,
Miyagoe-Suzuki Y, Takeda S, Tsujikawa K, Tsuchida K, Yamamoto H, Fukada S:
Fibrosis and adipogenesis originate from a common mesenchymal progenitor in
skeletal muscle. J Cell Sci 2011;124:3654-3664. |
|
|
|
|
|
22 Lukjanenko L,
Brachat S, Pierrel E, Lach-Trifilieff E, Feige JN: Genomic profiling reveals
that transient adipogenic activation is a hallmark of mouse models of
skeletal muscle regeneration. PloS One 2013;8:e71084. |
|
|
|
|
|
23 Kawai H, Nishino
H, Kusaka K, Naruo T, Tamaki Y, Iwasa M: Experimental glycerol myopathy: a
histological study. Acta Neuropathol 1990;80:192-197. |
|
|
|
|
|
24 Pisani DF,
Bottema CD, Butori C, Dani C, Dechesne CA: Mouse model of skeletal muscle
adiposity: a glycerol treatment approach. Biochem Biophys Res Commun
2010;396:767-773. |
|
|
|
|
|
25 Pagano AF,
Demangel R, Brioche T, Jublanc E, Bertrand-Gaday C, Candau R, Dechesne CA,
Dani C, Bonnieu A, Py G, Chopard A: Muscle Regeneration with Intermuscular
Adipose Tissue (IMAT) Accumulation Is Modulated by Mechanical Constraints. PloS One 2015;10:e0144230. |
|
|
|
|
|
26
Gratas-Delamarche A, Derbre F, Vincent S, Cillard J: Physical inactivity,
insulin resistance, and the oxidative-inflammatory loop. Free Radic Res 2014;48:93-108. |
|
|
|
|
|
27 Kohno S,
Yamashita Y, Abe T, Hirasaka K, Oarada M, Ohno A, Teshima-Kondo S,
Higashibata A, Choi I, Mills EM, Okumura Y, Terao J, Nikawa T: Unloading
stress disturbs muscle regeneration through perturbed recruitment and
function of macrophages. J Appl
Physiol (1985) 2012;112:1773-1782. |
|
|
|
|
|
28 Nguyen HX,
Tidball JG: Expression of a muscle-specific, nitric oxide synthase transgene
prevents muscle membrane injury and reduces muscle inflammation during
modified muscle use in mice. J
Physiol 2003;550:347-356. |
|
|
|
|
|
29 Petersen AM,
Pedersen BK: The anti-inflammatory effect of exercise. J Appl Physiol (1985) 2005;98:1154-1162. |
|
|
|
|
|
30 Pedersen BK,
Febbraio MA: Muscle as an endocrine organ: focus on muscle-derived
interleukin-6. Physiol Rev
2008;88:1379-1406. |
|
|
|
|
|
31 Hoffmann C,
Weigert C: Skeletal Muscle as an Endocrine Organ: The Role of Myokines in
Exercise Adaptations. Cold Spring Harb Perspect Med 2017;7:pii:a029793. |
|
|
|
|
|
32 Pagano AF,
Brioche T, Arc-Chagnaud C, Demangel R, Chopard A, Py G: Short-term disuse
promotes fatty acid infiltration into skeletal muscle. J Cachexia Sarcopenia Muscle 2018;9:335-347. |
|
|
|
|
|
33 Gilda JE, Gomes
AV: Western blotting using in-gel protein labeling as a normalization
control: stain-free technology. Methods Mol Biol 2015;1295:381-391. |
|
|
|
|
|
34 Matsuba Y, Goto
K, Morioka S, Naito T, Akema T, Hashimoto N, Sugiura T, Ohira Y, Beppu M,
Yoshioka T: Gravitational unloading inhibits the regenerative potential of
atrophied soleus muscle in mice. Acta Physiol (Oxf) 2009;196:329-339. |
|
|
|
|
|
35 Judson RN, Zhang
RH, Rossi FM: Tissue-resident mesenchymal stem/progenitor cells in skeletal
muscle: collaborators or saboteurs? FEBS J 2013;280:4100-4108. |
|
|
|
|
|
36 Kanzleiter T,
Rath M, Gorgens SW, Jensen J, Tangen DS, Kolnes AJ, Kolnes KJ, Lee S, Eckel
J, Schurmann A, Eckardt K: The myokine decorin is regulated by contraction
and involved in muscle hypertrophy. Biochem Biophys Res Commun
2014;450:1089-1094. |
|
|
|
|
|
37 Li Y, Li J, Zhu
J, Sun B, Branca M, Tang Y, Foster W, Xiao X, Huard J: Decorin gene transfer
promotes muscle cell differentiation and muscle regeneration. Mol Ther
2007;15:1616-1622. |
|
|
|
|
|
38 Hildebrand A,
Romaris M, Rasmussen LM, Heinegard D, Twardzik DR, Border WA, Ruoslahti E:
Interaction of the small interstitial proteoglycans biglycan, decorin and
fibromodulin with transforming growth factor beta. Biochem J
1994;302:527-534. |
|
|
|
|
|
39 Sato K, Li Y,
Foster W, Fukushima K, Badlani N, Adachi N, Usas A, Fu FH, Huard J:
Improvement of muscle healing through enhancement of muscle regeneration and
prevention of fibrosis. Muscle Nerve 2003;28:365-372. |
|
|
|
|
|
40 Comalada M, Cardo
M, Xaus J, Valledor AF, Lloberas J, Ventura F, Celada A: Decorin reverses the
repressive effect of autocrine-produced TGF-beta on mouse macrophage
activation. J Immunol 2003;170:4450-4456. |
|